Transcript: Mouse NM_019696.2

Mus musculus carboxypeptidase X 1 (M14 family) (Cpxm1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cpxm1 (56264)
Length:
2434
CDS:
124..2292

Additional Resources:

NCBI RefSeq record:
NM_019696.2
NBCI Gene record:
Cpxm1 (56264)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031285 GAGGGCATTAACCACGATGTT pLKO.1 2026 CDS 100% 4.950 6.930 N Cpxm1 n/a
2 TRCN0000031284 GCAGTTCTTATGCCATGAGTT pLKO.1 1212 CDS 100% 4.950 3.960 N Cpxm1 n/a
3 TRCN0000031288 GATCGTTGTCAAGAAGCGAAA pLKO.1 318 CDS 100% 4.050 3.240 N Cpxm1 n/a
4 TRCN0000031286 GCTGAGCAACAAGACACTGAA pLKO.1 586 CDS 100% 4.950 3.465 N Cpxm1 n/a
5 TRCN0000031287 GCTTGTGGTGTCCTATCCTTT pLKO.1 1593 CDS 100% 4.950 3.465 N Cpxm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.