Transcript: Mouse NM_019721.2

Mus musculus methyltransferase like 3 (Mettl3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mettl3 (56335)
Length:
2035
CDS:
138..1880

Additional Resources:

NCBI RefSeq record:
NM_019721.2
NBCI Gene record:
Mettl3 (56335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039112 CGTCAGTATCTTGGGCAAATT pLKO.1 1283 CDS 100% 13.200 10.560 N Mettl3 n/a
2 TRCN0000039113 GCACCCGCAAGATTGAGTTAT pLKO.1 1717 CDS 100% 13.200 9.240 N Mettl3 n/a
3 TRCN0000039109 CCAGTCATAAACCAGATGAAA pLKO.1 1666 CDS 100% 5.625 3.938 N Mettl3 n/a
4 TRCN0000039111 CCTCAGTGGATCTGTTGTGAT pLKO.1 1248 CDS 100% 4.950 3.465 N Mettl3 n/a
5 TRCN0000034718 GCTGCACTTCAGACGAATTAT pLKO.1 1025 CDS 100% 15.000 9.000 N METTL3 n/a
6 TRCN0000289814 GCTGCACTTCAGACGAATTAT pLKO_005 1025 CDS 100% 15.000 9.000 N METTL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.