Transcript: Mouse NM_019739.3

Mus musculus forkhead box O1 (Foxo1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Foxo1 (56458)
Length:
5552
CDS:
466..2424

Additional Resources:

NCBI RefSeq record:
NM_019739.3
NBCI Gene record:
Foxo1 (56458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019739.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054879 CCGCCAAACACCAGTCTAAAT pLKO.1 1681 CDS 100% 13.200 18.480 N Foxo1 n/a
2 TRCN0000234398 TGTAATGATGGGCCCTAATTC pLKO_005 1941 CDS 100% 13.200 18.480 N Foxo1 n/a
3 TRCN0000054878 CGGAGGATTGAACCAGTATAA pLKO.1 1803 CDS 100% 13.200 10.560 N Foxo1 n/a
4 TRCN0000233397 CGGAGGATTGAACCAGTATAA pLKO_005 1803 CDS 100% 13.200 10.560 N Foxo1 n/a
5 TRCN0000054882 CATGGACAACAACAGTAAATT pLKO.1 1224 CDS 100% 15.000 10.500 N Foxo1 n/a
6 TRCN0000233395 CATGGACAACAACAGTAAATT pLKO_005 1224 CDS 100% 15.000 10.500 N Foxo1 n/a
7 TRCN0000234399 TGGAAACCAGCCAGCTATAAA pLKO_005 3945 3UTR 100% 15.000 10.500 N Foxo1 n/a
8 TRCN0000233396 CCCAGTCCAAACTACTCAAAG pLKO_005 1705 CDS 100% 10.800 7.560 N Foxo1 n/a
9 TRCN0000054880 CCCGTGAAGACACCTTTACAA pLKO.1 2125 CDS 100% 5.625 3.938 N Foxo1 n/a
10 TRCN0000054881 CCCAGGACTCTTGAAAGAGTT pLKO.1 1830 CDS 100% 0.495 0.347 N Foxo1 n/a
11 TRCN0000020707 CGTGCCCTACTTCAAGGATAA pLKO.1 1035 CDS 100% 10.800 5.400 Y LOC391030 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019739.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.