Transcript: Mouse NM_019744.4

Mus musculus nuclear receptor coactivator 4 (Ncoa4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ncoa4 (27057)
Length:
3953
CDS:
49..1926

Additional Resources:

NCBI RefSeq record:
NM_019744.4
NBCI Gene record:
Ncoa4 (27057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019744.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225671 GCCCTAAGGACGTGCCTAATA pLKO_005 1601 CDS 100% 13.200 18.480 N Gm6768 n/a
2 TRCN0000225669 ACGCGAGCTCCTCAAGTATTG pLKO_005 554 CDS 100% 10.800 15.120 N Gm6768 n/a
3 TRCN0000095083 CGATCTCATCTATCAGCTTAA pLKO.1 270 CDS 100% 10.800 15.120 N Ncoa4 n/a
4 TRCN0000095080 CGGGCTGAACAGCAAATTAAA pLKO.1 154 CDS 100% 15.000 12.000 N Ncoa4 n/a
5 TRCN0000095079 CGTCATAAAGAATAGTTCCTT pLKO.1 1545 CDS 100% 3.000 2.400 N Ncoa4 n/a
6 TRCN0000218093 TGATTCCTTCCACGTCATAAA pLKO_005 1533 CDS 100% 13.200 9.240 N Gm6768 n/a
7 TRCN0000095081 CTCCTCAAGTATTGGGCCTTT pLKO.1 561 CDS 100% 4.050 2.835 N Ncoa4 n/a
8 TRCN0000225672 TCCTACAAACCTCGGCTTTAA pLKO_005 2612 3UTR 100% 13.200 7.920 N Gm6768 n/a
9 TRCN0000095082 GCTCCTCAAGTATTGGGCCTT pLKO.1 560 CDS 100% 2.160 1.296 N Ncoa4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019744.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.