Transcript: Mouse NM_019798.5

Mus musculus phosphodiesterase 4A, cAMP specific (Pde4a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pde4a (18577)
Length:
4150
CDS:
409..2241

Additional Resources:

NCBI RefSeq record:
NM_019798.5
NBCI Gene record:
Pde4a (18577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019798.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417467 TGTATCATGTATACGATATTC pLKO_005 841 CDS 100% 13.200 18.480 N Pde4a n/a
2 TRCN0000414780 GGAACGCGGAATGGAGATTAG pLKO_005 1527 CDS 100% 10.800 15.120 N Pde4a n/a
3 TRCN0000114965 CGATTTGGAGTCAAGACAGAT pLKO.1 724 CDS 100% 4.950 3.960 N Pde4a n/a
4 TRCN0000436967 ACTCACACACCTGTCGGAAAT pLKO_005 498 CDS 100% 10.800 7.560 N Pde4a n/a
5 TRCN0000114963 GCCATTCCTTCAGCCTTGAAA pLKO.1 2012 CDS 100% 5.625 3.938 N Pde4a n/a
6 TRCN0000114961 ACTCACCACAGACCACCTCAA pLKO.1 2289 3UTR 100% 4.050 2.835 N Pde4a n/a
7 TRCN0000114962 GCAAGAAGAGAACTGCGACAT pLKO.1 1206 CDS 100% 4.050 2.835 N Pde4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019798.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.