Transcript: Mouse NM_019807.2

Mus musculus acid phosphatase, prostate (Acpp), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Acpp (56318)
Length:
2667
CDS:
64..1209

Additional Resources:

NCBI RefSeq record:
NM_019807.2
NBCI Gene record:
Acpp (56318)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433320 ATTCTTGAACGACACCTATAA pLKO_005 333 CDS 100% 13.200 18.480 N Acpp n/a
2 TRCN0000437829 CAAGGCGCGTTGTAGTCAATA pLKO_005 1569 3UTR 100% 13.200 18.480 N Acpp n/a
3 TRCN0000080600 GACGCCATGATTAAGTTGAAA pLKO.1 748 CDS 100% 5.625 7.875 N Acpp n/a
4 TRCN0000080598 CCTGGGATTCTAAATTGGATA pLKO.1 1965 3UTR 100% 4.950 3.960 N Acpp n/a
5 TRCN0000419040 GAAGAGGCTTCATCCATATAA pLKO_005 594 CDS 100% 15.000 10.500 N Acpp n/a
6 TRCN0000414829 ATTATCTCTGCTATCACTTTA pLKO_005 780 CDS 100% 13.200 9.240 N Acpp n/a
7 TRCN0000080601 CACTACGAACTTGGAAGTTAT pLKO.1 292 CDS 100% 13.200 9.240 N Acpp n/a
8 TRCN0000080599 CAGGACTTTGATGAGTGCTAT pLKO.1 390 CDS 100% 4.950 3.465 N Acpp n/a
9 TRCN0000080602 CCTTTATTCTGCGAGAGTGTT pLKO.1 694 CDS 100% 4.950 3.465 N Acpp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.