Transcript: Mouse NM_019825.3

Mus musculus nuclear receptor coactivator 6 (Ncoa6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ncoa6 (56406)
Length:
6872
CDS:
142..6351

Additional Resources:

NCBI RefSeq record:
NM_019825.3
NBCI Gene record:
Ncoa6 (56406)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176319 CCTATGGTTCAACAGGGAAAT pLKO.1 1591 CDS 100% 10.800 15.120 N Ncoa6 n/a
2 TRCN0000303657 ACAAATGAACCCAGCTAATTT pLKO_005 891 CDS 100% 15.000 10.500 N NCOA6 n/a
3 TRCN0000176122 GCTTTGATCAACAGGGCTTAA pLKO.1 3962 CDS 100% 10.800 7.560 N Ncoa6 n/a
4 TRCN0000173430 CCTAGAGTACAGGGTGAACAT pLKO.1 6622 3UTR 100% 4.950 3.465 N Ncoa6 n/a
5 TRCN0000175145 GCAACAACAAATGATGATGAT pLKO.1 3243 CDS 100% 4.950 3.465 N Ncoa6 n/a
6 TRCN0000173546 GCCATGTATTGAAAGGCGCTA pLKO.1 6560 3UTR 100% 2.160 1.512 N Ncoa6 n/a
7 TRCN0000303658 GCCCATTGTTGGTCAACTTAT pLKO_005 2810 CDS 100% 13.200 9.240 N NCOA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.