Transcript: Mouse NM_019917.2

Mus musculus vomeronasal 2, receptor 26 (Vmn2r26), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r26 (56552)
Length:
2568
CDS:
1..2568

Additional Resources:

NCBI RefSeq record:
NM_019917.2
NBCI Gene record:
Vmn2r26 (56552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027868 CGACTTACCTTGACACCTGTT pLKO.1 802 CDS 100% 4.050 3.240 N Vmn2r26 n/a
2 TRCN0000027933 CCCTATAGCTACAAAGTCTAT pLKO.1 1201 CDS 100% 4.950 3.465 N Vmn2r26 n/a
3 TRCN0000027914 GCGTTGAAGATACAAGCCATA pLKO.1 179 CDS 100% 4.050 2.430 N Vmn2r26 n/a
4 TRCN0000027896 GCACTCAGAGTTTGGTCAAAT pLKO.1 2205 CDS 100% 13.200 6.600 Y Vmn2r26 n/a
5 TRCN0000027897 GCCATTAGTTTATCTGCCTTT pLKO.1 1801 CDS 100% 4.050 2.025 Y Vmn2r26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.