Transcript: Mouse NM_019918.2

Mus musculus vomeronasal 2, receptor 1 (Vmn2r1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r1 (56544)
Length:
2739
CDS:
1..2739

Additional Resources:

NCBI RefSeq record:
NM_019918.2
NBCI Gene record:
Vmn2r1 (56544)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028016 GCAGCTAATGTACTATATGAA pLKO.1 1398 CDS 100% 5.625 4.500 N Vmn2r1 n/a
2 TRCN0000027973 CCATCTTATCTTCGTGTACTA pLKO.1 577 CDS 100% 4.950 3.465 N Vmn2r1 n/a
3 TRCN0000027961 CCTTTGTGACAGTTGGGAGAT pLKO.1 1535 CDS 100% 4.050 2.835 N Vmn2r1 n/a
4 TRCN0000027989 GCTATACTTCTTCCTGCTCAA pLKO.1 533 CDS 100% 4.050 2.835 N Vmn2r1 n/a
5 TRCN0000027996 CCAAGTTTAATTTGTCTGGAT pLKO.1 104 CDS 100% 2.640 1.848 N Vmn2r1 n/a
6 TRCN0000104878 CCAAGGATGTTCAAGAACATT pLKO.1 2263 CDS 100% 0.563 0.281 Y Vmn2r-ps11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.