Transcript: Mouse NM_019969.3

Mus musculus pleiomorphic adenoma gene 1 (Plag1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Plag1 (56711)
Length:
4635
CDS:
604..2103

Additional Resources:

NCBI RefSeq record:
NM_019969.3
NBCI Gene record:
Plag1 (56711)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019969.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127444 GCGCCATTATTATCACTAAAT pLKO.1 2355 3UTR 100% 13.200 18.480 N Plag1 n/a
2 TRCN0000127445 CGCACAGAGATTTGGACGAAA pLKO.1 1257 CDS 100% 4.950 3.960 N Plag1 n/a
3 TRCN0000127448 CAAGGTGTGTTTGCAGAATTT pLKO.1 1059 CDS 100% 13.200 9.240 N Plag1 n/a
4 TRCN0000127446 CCCATAGATATGGATGCTGTT pLKO.1 1555 CDS 100% 4.050 2.835 N Plag1 n/a
5 TRCN0000127447 GCCTTTGTTTCTAAGTACAAA pLKO.1 817 CDS 100% 0.563 0.338 N Plag1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019969.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.