Transcript: Mouse NM_019971.3

Mus musculus platelet-derived growth factor, C polypeptide (Pdgfc), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Mus musculus (mouse)
Gene:
Pdgfc (54635)
Length:
3537
CDS:
1022..2059

Additional Resources:

NCBI RefSeq record:
NM_019971.3
NBCI Gene record:
Pdgfc (54635)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065798 GCCCGAAGTTTCCTCATACAT pLKO.1 1200 CDS 100% 5.625 7.875 N Pdgfc n/a
2 TRCN0000317595 GCCCGAAGTTTCCTCATACAT pLKO_005 1200 CDS 100% 5.625 7.875 N Pdgfc n/a
3 TRCN0000314012 TGTCAGTGTGTCCCACGTAAA pLKO_005 1901 CDS 100% 10.800 8.640 N Pdgfc n/a
4 TRCN0000065800 GTGCCTGTTGTCTCCATAATT pLKO.1 1872 CDS 100% 15.000 10.500 N Pdgfc n/a
5 TRCN0000317523 GTGCCTGTTGTCTCCATAATT pLKO_005 1872 CDS 100% 15.000 10.500 N Pdgfc n/a
6 TRCN0000313940 AGATCCAGAAGACGATATATG pLKO_005 1312 CDS 100% 13.200 9.240 N Pdgfc n/a
7 TRCN0000313939 GCTGATGCTGGCTATGGTAAA pLKO_005 2157 3UTR 100% 10.800 7.560 N Pdgfc n/a
8 TRCN0000065802 GTTGTCACTATATCTGGTAAT pLKO.1 1166 CDS 100% 10.800 7.560 N Pdgfc n/a
9 TRCN0000065801 CAGACTTCTAAAGGAAATCAT pLKO.1 1418 CDS 100% 5.625 3.938 N Pdgfc n/a
10 TRCN0000065799 GCTGACATTTGATGAGAGATT pLKO.1 1282 CDS 100% 4.950 3.465 N Pdgfc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.