Transcript: Mouse NM_019985.3

Mus musculus C-type lectin domain family 1, member b (Clec1b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Clec1b (56760)
Length:
1170
CDS:
319..1008

Additional Resources:

NCBI RefSeq record:
NM_019985.3
NBCI Gene record:
Clec1b (56760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019985.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424985 GAATTGTGCTTATCTTCATAA pLKO_005 897 CDS 100% 13.200 18.480 N Clec1b n/a
2 TRCN0000446781 GTGGAGATACCATGGAGATAG pLKO_005 633 CDS 100% 10.800 7.560 N Clec1b n/a
3 TRCN0000416184 TCAGTCCGTTGGATTGGATTA pLKO_005 781 CDS 100% 10.800 7.560 N Clec1b n/a
4 TRCN0000174262 CAAGAAATTCTGCCAAGAGTT pLKO.1 546 CDS 100% 4.950 3.465 N Clec1b n/a
5 TRCN0000194551 GCAGAATGCAACACTTGTGAA pLKO.1 714 CDS 100% 4.950 3.465 N Clec1b n/a
6 TRCN0000175011 GCCAAGAGTTGATTAGACAAT pLKO.1 557 CDS 100% 4.950 3.465 N Clec1b n/a
7 TRCN0000194495 GATTGGATTATCACGCCAGAA pLKO.1 792 CDS 100% 4.050 2.835 N Clec1b n/a
8 TRCN0000173918 GCGTAACCTAACATGGGAAGA pLKO.1 672 CDS 100% 4.050 2.835 N Clec1b n/a
9 TRCN0000173527 GCTTTAGTTCTGCTGATCTCA pLKO.1 415 CDS 100% 3.000 2.100 N Clec1b n/a
10 TRCN0000193476 GTGCTTATCTTCATAATGGAA pLKO.1 902 CDS 100% 3.000 2.100 N Clec1b n/a
11 TRCN0000174836 GAACTCTAAGAAAGACTGGAT pLKO.1 810 CDS 100% 2.640 1.848 N Clec1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019985.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.