Transcript: Mouse NM_020003.1

Mus musculus glycosylated lysosomal membrane protein (Glmp), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Glmp (56700)
Length:
1557
CDS:
60..1274

Additional Resources:

NCBI RefSeq record:
NM_020003.1
NBCI Gene record:
Glmp (56700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264982 TGCCAACCTGAGTGCCGATTT pLKO_005 551 CDS 100% 10.800 15.120 N Glmp n/a
2 TRCN0000264983 TTCTGAGTACCAGTCCATAAA pLKO_005 1250 CDS 100% 13.200 9.240 N Glmp n/a
3 TRCN0000173983 GCCAGGTATCTATGGAGGTTA pLKO.1 175 CDS 100% 4.950 3.465 N Glmp n/a
4 TRCN0000176348 CAGGTATCTATGGAGGTTATT pLKO.1 177 CDS 100% 13.200 7.920 N Glmp n/a
5 TRCN0000264981 TCGTGGAAACCATTCCCTATT pLKO_005 734 CDS 100% 10.800 6.480 N Glmp n/a
6 TRCN0000264980 AGAAGCCAGCCTCAACCTACT pLKO_005 1362 3UTR 100% 4.050 2.430 N Glmp n/a
7 TRCN0000194365 CCTGGAACAATATCACCAACT pLKO.1 520 CDS 100% 4.050 2.430 N Glmp n/a
8 TRCN0000216579 GAACTCCATCGATGATGAATA pLKO.1 812 CDS 100% 13.200 6.600 Y Glmp n/a
9 TRCN0000264979 GGTATCTATGGAGGTTATTTC pLKO_005 179 CDS 100% 13.200 6.600 Y Glmp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.