Transcript: Mouse NM_020024.3

Mus musculus TATA-box binding protein associated factor 10 (Taf10), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Taf10 (24075)
Length:
787
CDS:
21..677

Additional Resources:

NCBI RefSeq record:
NM_020024.3
NBCI Gene record:
Taf10 (24075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039353 TCGCAAGTACACCCTAACCAT pLKO.1 590 CDS 100% 3.000 4.200 N Taf10 n/a
2 TRCN0000014604 CCAGAAATTCATCTCAGATAT pLKO.1 497 CDS 100% 13.200 9.240 N TAF10 n/a
3 TRCN0000277977 CCAGAAATTCATCTCAGATAT pLKO_005 497 CDS 100% 13.200 9.240 N TAF10 n/a
4 TRCN0000055127 TCTCACTAGCTGCCCAGAAAT pLKO.1 484 CDS 100% 13.200 9.240 N Taf10 n/a
5 TRCN0000039351 CTTGATGCAGTTGGAGGATTA pLKO.1 377 CDS 100% 10.800 7.560 N Taf10 n/a
6 TRCN0000014607 AGATGCAGTGACTGGTTACTA pLKO.1 413 CDS 100% 5.625 3.938 N TAF10 n/a
7 TRCN0000277978 AGATGCAGTGACTGGTTACTA pLKO_005 413 CDS 100% 5.625 3.938 N TAF10 n/a
8 TRCN0000039350 CTCAGCGAGTATGGCATCAAT pLKO.1 630 CDS 100% 5.625 3.938 N Taf10 n/a
9 TRCN0000039352 CACACCTCTAGTGGACTTCTT pLKO.1 359 CDS 100% 4.950 3.465 N Taf10 n/a
10 TRCN0000055125 CGAGTATGGCATCAATGTGAA pLKO.1 635 CDS 100% 4.950 3.465 N Taf10 n/a
11 TRCN0000039349 GCCCAGAAATTCATCTCAGAT pLKO.1 495 CDS 100% 4.950 3.465 N Taf10 n/a
12 TRCN0000055124 AGTGGACTTCTTGATGCAGTT pLKO.1 368 CDS 100% 4.050 2.835 N Taf10 n/a
13 TRCN0000014605 CCCACGCATAATTCGGCTCAT pLKO.1 464 CDS 100% 4.050 2.835 N TAF10 n/a
14 TRCN0000297068 CCCACGCATAATTCGGCTCAT pLKO_005 464 CDS 100% 4.050 2.835 N TAF10 n/a
15 TRCN0000055123 GATATTGCCAATGATGCCCTA pLKO.1 513 CDS 100% 2.160 1.512 N Taf10 n/a
16 TRCN0000055126 CAAGAGCAAGGATCGCAAGTA pLKO.1 578 CDS 100% 4.950 2.970 N Taf10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.