Transcript: Human NM_020063.2

Homo sapiens BarH like homeobox 2 (BARHL2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
BARHL2 (343472)
Length:
2044
CDS:
108..1271

Additional Resources:

NCBI RefSeq record:
NM_020063.2
NBCI Gene record:
BARHL2 (343472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020798 CAGCAAGACCAAACTCGACAA pLKO.1 677 CDS 100% 4.050 5.670 N BARHL2 n/a
2 TRCN0000433450 GCGCCTTCTTCTCCTATCTCA pLKO_005 288 CDS 100% 3.000 4.200 N BARHL2 n/a
3 TRCN0000020794 CGCCTTATTTCTATCACCCAA pLKO.1 1045 CDS 100% 2.640 3.696 N BARHL2 n/a
4 TRCN0000020797 TGTTCGGAGATTGATACCGTA pLKO.1 261 CDS 100% 2.640 3.696 N BARHL2 n/a
5 TRCN0000020796 AGCTCAATCAACTGGAGCGTA pLKO.1 835 CDS 100% 2.640 2.112 N BARHL2 n/a
6 TRCN0000231199 AGGAAGGAGACCGGGAGATTA pLKO_005 742 CDS 100% 13.200 9.240 N Barhl2 n/a
7 TRCN0000427470 AGGAAGGAGACCGGGAGATTA pLKO_005 742 CDS 100% 13.200 9.240 N BARHL2 n/a
8 TRCN0000428773 ATTCCCAGAGCGACATCAAAT pLKO_005 706 CDS 100% 13.200 9.240 N BARHL2 n/a
9 TRCN0000412834 GACATCTTGGGCGACAGCAAA pLKO_005 543 CDS 100% 4.950 3.465 N BARHL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.