Transcript: Human NM_020133.3

Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 4 (AGPAT4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
AGPAT4 (56895)
Length:
7923
CDS:
214..1350

Additional Resources:

NCBI RefSeq record:
NM_020133.3
NBCI Gene record:
AGPAT4 (56895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020133.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035163 GAGTCCTAAACGGAAAGAAAT pLKO.1 938 CDS 100% 13.200 18.480 N AGPAT4 n/a
2 TRCN0000315809 GAGTCCTAAACGGAAAGAAAT pLKO_005 938 CDS 100% 13.200 18.480 N AGPAT4 n/a
3 TRCN0000294493 GTGATCATAGAAAGGGTATTT pLKO_005 1623 3UTR 100% 13.200 18.480 N AGPAT4 n/a
4 TRCN0000035161 CGTGGTTCTCAACCACAAGTT pLKO.1 486 CDS 100% 0.495 0.693 N AGPAT4 n/a
5 TRCN0000035160 GCTGGCCTATGTCCCAATTAT pLKO.1 588 CDS 100% 15.000 10.500 N AGPAT4 n/a
6 TRCN0000294482 ATGATTGGTGTGACGGAAATT pLKO_005 1276 CDS 100% 13.200 9.240 N AGPAT4 n/a
7 TRCN0000035159 GCCCATTAACAAGCAGCTCTT pLKO.1 330 CDS 100% 4.050 2.835 N AGPAT4 n/a
8 TRCN0000315811 GCCCATTAACAAGCAGCTCTT pLKO_005 330 CDS 100% 4.050 2.835 N AGPAT4 n/a
9 TRCN0000035162 GCTCTACCCTTTCTTCCAGTT pLKO.1 1167 CDS 100% 4.050 2.430 N AGPAT4 n/a
10 TRCN0000315810 GCTCTACCCTTTCTTCCAGTT pLKO_005 1167 CDS 100% 4.050 2.430 N AGPAT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020133.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.