Transcript: Human NM_020137.5

Homo sapiens GRIP1 associated protein 1 (GRIPAP1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GRIPAP1 (56850)
Length:
3031
CDS:
36..2561

Additional Resources:

NCBI RefSeq record:
NM_020137.5
NBCI Gene record:
GRIPAP1 (56850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020137.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130687 CTTGCTAAGCTCTCCGAGAAA pLKO.1 717 CDS 100% 4.950 6.930 N GRIPAP1 n/a
2 TRCN0000148399 CTTGGGAGACTGGACATTAAA pLKO.1 2663 3UTR 100% 15.000 10.500 N GRIPAP1 n/a
3 TRCN0000127847 GCACTGAGCAAGAGCAAGAAA pLKO.1 207 CDS 100% 5.625 3.938 N GRIPAP1 n/a
4 TRCN0000149416 CAGGGATTTCTCCTTCTTCTT pLKO.1 2767 3UTR 100% 4.950 3.465 N GRIPAP1 n/a
5 TRCN0000130436 GAACTTCAAGCTCAGGTACAT pLKO.1 1563 CDS 100% 4.950 3.465 N GRIPAP1 n/a
6 TRCN0000149227 GAACTACGCAAGAATGGTGTT pLKO.1 123 CDS 100% 4.050 2.835 N GRIPAP1 n/a
7 TRCN0000128002 GCTCAGGTACATTCCATGGAT pLKO.1 1572 CDS 100% 3.000 2.100 N GRIPAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020137.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.