Transcript: Mouse NM_020259.4

Mus musculus Hedgehog-interacting protein (Hhip), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Hhip (15245)
Length:
9094
CDS:
494..2596

Additional Resources:

NCBI RefSeq record:
NM_020259.4
NBCI Gene record:
Hhip (15245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098150 AGGTTGTATAACAGAAGGATT pLKO.1 2806 3UTR 100% 4.950 3.960 N Hhip n/a
2 TRCN0000098151 CCGAACAAGTGCCTCTGTAAA pLKO.1 2447 CDS 100% 13.200 9.240 N Hhip n/a
3 TRCN0000098152 CCTGGCATTCCATCCCAATTA pLKO.1 1351 CDS 100% 13.200 9.240 N Hhip n/a
4 TRCN0000127533 CTTGGTCCTCAATGTGAACAA pLKO.1 2477 CDS 100% 4.950 3.465 N HHIP n/a
5 TRCN0000098153 GCTGGATCTCACAAGTTACAT pLKO.1 2569 CDS 100% 5.625 3.375 N Hhip n/a
6 TRCN0000098154 CCTGAAAGAGATGTCCTGGAT pLKO.1 869 CDS 100% 2.640 1.584 N Hhip n/a
7 TRCN0000127693 GCTTCTTTGAAGGAGATGCTA pLKO.1 543 CDS 100% 3.000 2.100 N HHIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.