Transcript: Mouse NM_020260.2

Mus musculus Rho GTPase activating protein 31 (Arhgap31), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Arhgap31 (12549)
Length:
7722
CDS:
363..4640

Additional Resources:

NCBI RefSeq record:
NM_020260.2
NBCI Gene record:
Arhgap31 (12549)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105802 GCAGGATGAAAGCCGTACTAT pLKO.1 1037 CDS 100% 5.625 7.875 N Arhgap31 n/a
2 TRCN0000105801 CGAGACTTCGACAAGCTGTTT pLKO.1 4559 CDS 100% 4.950 6.930 N Arhgap31 n/a
3 TRCN0000105803 CCTAATCTTATTCCCTATCAT pLKO.1 4355 CDS 100% 5.625 3.938 N Arhgap31 n/a
4 TRCN0000105804 GCAAGCCCAAATGAGAAGCAA pLKO.1 2844 CDS 100% 3.000 2.100 N Arhgap31 n/a
5 TRCN0000105800 GCCTCCATTATCATTCTCTTA pLKO.1 4960 3UTR 100% 4.950 2.970 N Arhgap31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.