Transcript: Mouse NM_020268.3

Mus musculus kallikrein 1-related peptidase b27 (Klk1b27), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Klk1b27 (16619)
Length:
889
CDS:
52..843

Additional Resources:

NCBI RefSeq record:
NM_020268.3
NBCI Gene record:
Klk1b27 (16619)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020268.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032207 GCTCCGCTCCAACAAATATAT pLKO.1 177 CDS 100% 15.000 10.500 N Klk1b27 n/a
2 TRCN0000032206 GTCTAGAATAATTGGAGGATT pLKO.1 117 CDS 100% 4.950 3.465 N Klk1b27 n/a
3 TRCN0000032204 CATCCCACATCCTGAGGACAA pLKO.1 387 CDS 100% 4.050 2.835 N Klk1b27 n/a
4 TRCN0000032208 GCCAAAGCCTACGTACATAAA pLKO.1 610 CDS 100% 13.200 7.920 N Klk1b27 n/a
5 TRCN0000032205 GCATAATGTTTGGCTGGGCAA pLKO.1 270 CDS 100% 2.160 1.296 N Klk1b27 n/a
6 TRCN0000031747 CCACTGATCTGTGATGGTGTT pLKO.1 703 CDS 100% 4.050 2.025 Y Klk1b5 n/a
7 TRCN0000031370 CCCAATGAGAACTGTGCCAAA pLKO.1 595 CDS 100% 4.050 2.025 Y Egfbp2 n/a
8 TRCN0000032026 CCCACTGATCTGTGATGGTAT pLKO.1 702 CDS 100% 4.950 2.475 Y Klk1b4 n/a
9 TRCN0000031306 CCTGCTGACATCACAGATGTT pLKO.1 442 CDS 100% 4.950 2.475 Y Klk1b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020268.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.