Transcript: Mouse NM_020274.4

Mus musculus 5-hydroxytryptamine (serotonin) receptor 3B (Htr3b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Htr3b (57014)
Length:
2411
CDS:
206..1519

Additional Resources:

NCBI RefSeq record:
NM_020274.4
NBCI Gene record:
Htr3b (57014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020274.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439603 ACCGCTGGTCTCACTTGATAT pLKO_005 1528 3UTR 100% 13.200 18.480 N Htr3b n/a
2 TRCN0000102960 CCCTGCTCAAACCTGCTTAAA pLKO.1 1974 3UTR 100% 13.200 18.480 N Htr3b n/a
3 TRCN0000102964 CCTATGTATACGTGAACTCTT pLKO.1 591 CDS 100% 4.950 6.930 N Htr3b n/a
4 TRCN0000102962 CCTCTTGATACCTAGCATCTT pLKO.1 928 CDS 100% 4.950 6.930 N Htr3b n/a
5 TRCN0000433889 GATGCCGAGGAGTCTAGATTG pLKO_005 1232 CDS 100% 10.800 7.560 N Htr3b n/a
6 TRCN0000102961 GCCATCCTGTATCGCTTTGAT pLKO.1 1412 CDS 100% 5.625 3.938 N Htr3b n/a
7 TRCN0000102963 CCTCACCTTTAATAGCATTCT pLKO.1 703 CDS 100% 4.950 3.465 N Htr3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020274.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.