Transcript: Mouse NM_020286.3

Mus musculus tetraspanin 32 (Tspan32), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tspan32 (27027)
Length:
1697
CDS:
261..950

Additional Resources:

NCBI RefSeq record:
NM_020286.3
NBCI Gene record:
Tspan32 (27027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379437 TCTATGGCATCAGGAACATAA pLKO_005 1300 3UTR 100% 13.200 18.480 N Tspan32 n/a
2 TRCN0000109823 GCCGTCATCCAGGACACGTTT pLKO.1 618 CDS 100% 1.650 2.310 N Tspan32 n/a
3 TRCN0000109821 GACACCTATGACTTCGTGTAT pLKO.1 552 CDS 100% 4.950 3.960 N Tspan32 n/a
4 TRCN0000379552 ATGTTGAGGTCAACCAATTTC pLKO_005 1333 3UTR 100% 13.200 9.240 N Tspan32 n/a
5 TRCN0000109822 CTGTGGACACACTACAGTATT pLKO.1 750 CDS 100% 13.200 9.240 N Tspan32 n/a
6 TRCN0000381198 GATCCTCAAAGGAGTAGATAA pLKO_005 1100 3UTR 100% 13.200 9.240 N Tspan32 n/a
7 TRCN0000109820 GCCCACAGAGATGAAGTCTTT pLKO.1 1069 3UTR 100% 4.950 3.465 N Tspan32 n/a
8 TRCN0000109824 GCTGCGGGTTTCCTGTGCTTT pLKO.1 453 CDS 100% 1.650 1.155 N Tspan32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.