Transcript: Mouse NM_020332.4

Mus musculus progressive ankylosis (Ank), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Ank (11732)
Length:
3511
CDS:
328..1806

Additional Resources:

NCBI RefSeq record:
NM_020332.4
NBCI Gene record:
Ank (11732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020332.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311151 TACGGGCTGGCGTATTCTTTG pLKO_005 481 CDS 100% 10.800 8.640 N Ank n/a
2 TRCN0000304838 CAAGGAGGATGCAGTAGAAAT pLKO_005 450 CDS 100% 13.200 9.240 N Ank n/a
3 TRCN0000436436 CCTCAATCTCAGATGTCATAG pLKO_005 818 CDS 100% 10.800 7.560 N ANKH n/a
4 TRCN0000098167 CCCAACGTCTCTGAGAAGATT pLKO.1 1363 CDS 100% 5.625 3.938 N Ank n/a
5 TRCN0000316353 CCCAACGTCTCTGAGAAGATT pLKO_005 1363 CDS 100% 5.625 3.938 N Ank n/a
6 TRCN0000098165 CCCTTGGACAATCTCCACTTT pLKO.1 2098 3UTR 100% 4.950 3.465 N Ank n/a
7 TRCN0000316429 CCCTTGGACAATCTCCACTTT pLKO_005 2098 3UTR 100% 4.950 3.465 N Ank n/a
8 TRCN0000098166 GCCTCAATCTCAGATGTCATA pLKO.1 817 CDS 100% 4.950 3.465 N Ank n/a
9 TRCN0000316428 GCCTCAATCTCAGATGTCATA pLKO_005 817 CDS 100% 4.950 3.465 N Ank n/a
10 TRCN0000098169 GCAATAAACTGGCGAACACAA pLKO.1 1253 CDS 100% 4.950 2.970 N Ank n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020332.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.