Transcript: Human NM_020365.5

Homo sapiens eukaryotic translation initiation factor 2B subunit gamma (EIF2B3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
EIF2B3 (8891)
Length:
1900
CDS:
113..1471

Additional Resources:

NCBI RefSeq record:
NM_020365.5
NBCI Gene record:
EIF2B3 (8891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020365.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083965 CGGAGTGAACTGATTCCATAT pLKO.1 785 CDS 100% 10.800 7.560 N EIF2B3 n/a
2 TRCN0000289406 CGGAGTGAACTGATTCCATAT pLKO_005 785 CDS 100% 10.800 7.560 N EIF2B3 n/a
3 TRCN0000083963 GCAGATTCTTTGCGCTACATA pLKO.1 371 CDS 100% 5.625 3.938 N EIF2B3 n/a
4 TRCN0000307060 GCAGATTCTTTGCGCTACATA pLKO_005 371 CDS 100% 5.625 3.938 N EIF2B3 n/a
5 TRCN0000083967 GCCCACCTCTACTGTTTGAAA pLKO.1 716 CDS 100% 5.625 3.938 N EIF2B3 n/a
6 TRCN0000289407 GCCCACCTCTACTGTTTGAAA pLKO_005 716 CDS 100% 5.625 3.938 N EIF2B3 n/a
7 TRCN0000083964 GCCAAAGCTAAACGAGTGAAT pLKO.1 1412 CDS 100% 4.950 3.465 N EIF2B3 n/a
8 TRCN0000307059 GCCAAAGCTAAACGAGTGAAT pLKO_005 1412 CDS 100% 4.950 3.465 N EIF2B3 n/a
9 TRCN0000267417 GGATGAAGAGCTGGTCATTAA pLKO_005 640 CDS 100% 13.200 7.920 N Eif2b3 n/a
10 TRCN0000083966 CCAGTTGGGAACAAACCTTTA pLKO.1 197 CDS 100% 10.800 6.480 N EIF2B3 n/a
11 TRCN0000289408 CCAGTTGGGAACAAACCTTTA pLKO_005 197 CDS 100% 10.800 6.480 N EIF2B3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020365.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.