Transcript: Human NM_020414.4

Homo sapiens DEAD-box helicase 24 (DDX24), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DDX24 (57062)
Length:
5573
CDS:
90..2669

Additional Resources:

NCBI RefSeq record:
NM_020414.4
NBCI Gene record:
DDX24 (57062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312586 CCCACGTACCTCGGAGATTTA pLKO_005 2081 CDS 100% 13.200 18.480 N DDX24 n/a
2 TRCN0000312587 TCCGTTTAGCTCGACAGATTG pLKO_005 2275 CDS 100% 10.800 15.120 N DDX24 n/a
3 TRCN0000050317 CCAAGGTCATTGACCTCACAA pLKO.1 1732 CDS 100% 4.950 6.930 N DDX24 n/a
4 TRCN0000050315 CGGAGATTTATGTCCACCGAA pLKO.1 2092 CDS 100% 2.640 3.696 N DDX24 n/a
5 TRCN0000050316 CGTGACAAACTGGACATCCTT pLKO.1 771 CDS 100% 3.000 2.400 N DDX24 n/a
6 TRCN0000312585 CTGAGGATGTGATCAACTTTA pLKO_005 2167 CDS 100% 13.200 9.240 N DDX24 n/a
7 TRCN0000312527 TTTCTGTTCTCTGGCTATTTG pLKO_005 2701 3UTR 100% 13.200 9.240 N DDX24 n/a
8 TRCN0000050314 CGCTCAAGAAAGATGAGGATA pLKO.1 2203 CDS 100% 4.950 3.465 N DDX24 n/a
9 TRCN0000327727 CGCTCAAGAAAGATGAGGATA pLKO_005 2203 CDS 100% 4.950 3.465 N DDX24 n/a
10 TRCN0000050313 GACTGCACATTGGTTTCTGTT pLKO.1 2688 3UTR 100% 4.950 3.465 N DDX24 n/a
11 TRCN0000104064 GCTCGAATCCTTCATAAGAAA pLKO.1 1641 CDS 100% 5.625 7.875 N Ddx24 n/a
12 TRCN0000317018 GCTCGAATCCTTCATAAGAAA pLKO_005 1641 CDS 100% 5.625 7.875 N Ddx24 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4072 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.