Transcript: Human NM_020442.5

Homo sapiens valyl-tRNA synthetase 2, mitochondrial (VARS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-28
Taxon:
Homo sapiens (human)
Gene:
VARS2 (57176)
Length:
3622
CDS:
165..3356

Additional Resources:

NCBI RefSeq record:
NM_020442.5
NBCI Gene record:
VARS2 (57176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020442.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240928 TACGAGAGGGCTTCTTCAAAC pLKO_005 517 CDS 100% 10.800 15.120 N VARS2 n/a
2 TRCN0000188971 GACTCGCGATACACACATCTA pLKO.1 1224 CDS 100% 4.950 6.930 N VARS2 n/a
3 TRCN0000161589 GCTCTTCGCTTTATCCTCAAT pLKO.1 2418 CDS 100% 4.950 6.930 N VARS2 n/a
4 TRCN0000240929 GTCACCTGCAGAATCCATTAA pLKO_005 365 CDS 100% 13.200 9.240 N VARS2 n/a
5 TRCN0000240932 TCAACTGGTCATGTGCTTTAA pLKO_005 994 CDS 100% 13.200 9.240 N VARS2 n/a
6 TRCN0000240930 AGATCCAGCTACCTCTGTTAG pLKO_005 3142 CDS 100% 10.800 7.560 N VARS2 n/a
7 TRCN0000240931 GACCTGTCTTTGAGGACAAAC pLKO_005 3389 3UTR 100% 10.800 7.560 N VARS2 n/a
8 TRCN0000204021 GATGTCCTAGACACATGGTTT pLKO.1 1905 CDS 100% 4.950 3.465 N VARS2 n/a
9 TRCN0000164304 CCGAAGGTACAAGTTGCAGAA pLKO.1 3167 CDS 100% 4.050 2.835 N VARS2 n/a
10 TRCN0000188425 CTGGTTCAGATCATGCAGGAA pLKO.1 706 CDS 100% 2.640 1.848 N VARS2 n/a
11 TRCN0000204615 GTCAGAGACTATGTGGTCCAT pLKO.1 3441 3UTR 100% 2.640 1.848 N VARS2 n/a
12 TRCN0000160633 CCTAAGGAGTTAGTATTGTAT pLKO.1 396 CDS 100% 5.625 3.375 N VARS2 n/a
13 TRCN0000203526 GTCTTTGAGGACAAACAGATT pLKO.1 3394 3UTR 100% 4.950 2.970 N VARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020442.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.