Transcript: Mouse NM_020497.2

Mus musculus zinc finger protein (C2H2 type) 276 (Zfp276), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Zfp276 (57247)
Length:
4877
CDS:
522..2366

Additional Resources:

NCBI RefSeq record:
NM_020497.2
NBCI Gene record:
Zfp276 (57247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020497.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081878 CCAGCGACTATACACACATTT pLKO.1 3476 3UTR 100% 13.200 18.480 N Zfp276 n/a
2 TRCN0000081880 CCGCAATTACATCTGTGACGA pLKO.1 2000 CDS 100% 2.640 3.696 N Zfp276 n/a
3 TRCN0000244247 CCACACAGAGGTCCGCAATTA pLKO_005 1988 CDS 100% 13.200 10.560 N Zfp276 n/a
4 TRCN0000081881 GAGCGAAGATGAGAGTGATAA pLKO.1 1616 CDS 100% 13.200 9.240 N Zfp276 n/a
5 TRCN0000244345 GGCATGAAGAAGCACATTAAG pLKO_005 1869 CDS 100% 13.200 9.240 N Zfp276 n/a
6 TRCN0000235904 TCGTGACAGTACATCCATTTA pLKO_005 4101 3UTR 100% 13.200 9.240 N Zfp276 n/a
7 TRCN0000235903 CAAGAACTGCTACACCCAATT pLKO_005 932 CDS 100% 10.800 7.560 N Zfp276 n/a
8 TRCN0000244327 CCACAACCTCAACGTGCATAT pLKO_005 2219 CDS 100% 10.800 7.560 N Zfp276 n/a
9 TRCN0000081882 GACAGTGCATTAGCAGTGAAA pLKO.1 1284 CDS 100% 4.950 3.465 N Zfp276 n/a
10 TRCN0000081879 CCAAGTTGGATCTGAGACCAA pLKO.1 1400 CDS 100% 2.640 1.848 N Zfp276 n/a
11 TRCN0000017765 CCACCATCTACAAGTGTCCTT pLKO.1 1813 CDS 100% 2.640 1.848 N ZNF276 n/a
12 TRCN0000017767 CCTTTGAGCCTTACCCAGAAA pLKO.1 1666 CDS 100% 4.950 2.970 N ZNF276 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020497.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.