Transcript: Mouse NM_020507.3

Mus musculus transducer of ERBB2, 2 (Tob2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tob2 (57259)
Length:
3994
CDS:
498..1535

Additional Resources:

NCBI RefSeq record:
NM_020507.3
NBCI Gene record:
Tob2 (57259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313176 GCCTCAGCTACAACCTGAATA pLKO_005 1465 CDS 100% 13.200 9.240 N Tob2 n/a
2 TRCN0000313249 TATTCTGCCTGCCTCTGATTT pLKO_005 1728 3UTR 100% 13.200 9.240 N Tob2 n/a
3 TRCN0000313250 TCGAGGTATCCTACCAGATTG pLKO_005 787 CDS 100% 10.800 7.560 N Tob2 n/a
4 TRCN0000088401 GAGCGGCTTCTGAGAAAGAAA pLKO.1 594 CDS 100% 5.625 3.938 N Tob2 n/a
5 TRCN0000312197 GAGCGGCTTCTGAGAAAGAAA pLKO_005 594 CDS 100% 5.625 3.938 N Tob2 n/a
6 TRCN0000088399 CACCTTTACTACTGCCTCTTT pLKO.1 1019 CDS 100% 4.950 3.465 N Tob2 n/a
7 TRCN0000088400 CGGTGCTAACAGCCTGTTCTT pLKO.1 1421 CDS 100% 4.950 3.465 N Tob2 n/a
8 TRCN0000088398 GCACTGCATAAGAAACTGGTT pLKO.1 2497 3UTR 100% 2.640 1.848 N Tob2 n/a
9 TRCN0000088402 CATCATCTCCTACTTATACAA pLKO.1 530 CDS 100% 5.625 3.375 N Tob2 n/a
10 TRCN0000349429 CATCATCTCCTACTTATACAA pLKO_005 530 CDS 100% 5.625 3.375 N Tob2 n/a
11 TRCN0000004165 GAGCTGAGTGTCTGGATTGAT pLKO.1 762 CDS 100% 5.625 3.938 N TOB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.