Transcript: Mouse NM_020512.2

Mus musculus olfactory receptor 1507 (Olfr1507), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Olfr1507 (57269)
Length:
1112
CDS:
85..1026

Additional Resources:

NCBI RefSeq record:
NM_020512.2
NBCI Gene record:
Olfr1507 (57269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185122 CGAAAGTACAGATGGCTATTT pLKO.1 155 CDS 100% 13.200 18.480 N Olfr1507 n/a
2 TRCN0000203445 CGTATCACTGAGATTCTCGTT pLKO.1 670 CDS 100% 2.640 3.696 N Olfr1507 n/a
3 TRCN0000202748 CCATTTGTAAACCTTTGAGGT pLKO.1 467 CDS 100% 2.640 1.848 N Olfr1507 n/a
4 TRCN0000202713 CCTTTATTGATGTCTGCCATT pLKO.1 293 CDS 100% 4.050 2.025 Y Olfr1507 n/a
5 TRCN0000202530 CATCCTCATTGTCATAACAAT pLKO.1 219 CDS 100% 0.563 0.281 Y Olfr1508 n/a
6 TRCN0000185126 CCATGTATTTCTTCCTCAGTA pLKO.1 266 CDS 100% 4.950 2.475 Y Olfr1491 n/a
7 TRCN0000186115 CCCATGTATTTCTTCCTCAGT pLKO.1 265 CDS 100% 2.640 1.320 Y Olfr1491 n/a
8 TRCN0000028987 CCCATGTATTTCTTCCTCAAT pLKO.1 265 CDS 100% 4.950 2.475 Y Olfr32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.