Transcript: Mouse NM_020513.2

Mus musculus olfactory receptor 1508 (Olfr1508), mRNA.

Source:
NCBI, updated 2017-04-28
Taxon:
Mus musculus (mouse)
Gene:
Olfr1508 (57270)
Length:
1865
CDS:
579..1511

Additional Resources:

NCBI RefSeq record:
NM_020513.2
NBCI Gene record:
Olfr1508 (57270)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187636 GCTGATCTCTGTGGTATGTTT pLKO.1 1199 CDS 100% 5.625 3.938 N Olfr1508 n/a
2 TRCN0000187035 CCATTAGTACAAATGGCTGTT pLKO.1 648 CDS 100% 0.405 0.284 N Olfr1508 n/a
3 TRCN0000202713 CCTTTATTGATGTCTGCCATT pLKO.1 787 CDS 100% 4.050 2.025 Y Olfr1507 n/a
4 TRCN0000202530 CATCCTCATTGTCATAACAAT pLKO.1 713 CDS 100% 0.563 0.281 Y Olfr1508 n/a
5 TRCN0000185126 CCATGTATTTCTTCCTCAGTA pLKO.1 760 CDS 100% 4.950 2.475 Y Olfr1491 n/a
6 TRCN0000186115 CCCATGTATTTCTTCCTCAGT pLKO.1 759 CDS 100% 2.640 1.320 Y Olfr1491 n/a
7 TRCN0000028987 CCCATGTATTTCTTCCTCAAT pLKO.1 759 CDS 100% 4.950 2.475 Y Olfr32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.