Transcript: Mouse NM_020557.4

Mus musculus cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial (Cmpk2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cmpk2 (22169)
Length:
3215
CDS:
138..1481

Additional Resources:

NCBI RefSeq record:
NM_020557.4
NBCI Gene record:
Cmpk2 (22169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020557.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025132 GTTTCGTCAGAAGGTGGAAAT pLKO.1 1352 CDS 100% 10.800 15.120 N Cmpk2 n/a
2 TRCN0000226327 TACCAACTTCTTGGGATATAT pLKO_005 1683 3UTR 100% 0.000 0.000 N Cmpk2 n/a
3 TRCN0000025131 TCTGCTTAACTCTGCGGTGTT pLKO.1 755 CDS 100% 4.050 3.240 N Cmpk2 n/a
4 TRCN0000226326 CCAGAGTTCTGGTCGTTAATT pLKO_005 1463 CDS 100% 15.000 10.500 N Cmpk2 n/a
5 TRCN0000218652 CAACCAACTTTCCTGTTATTG pLKO_005 1102 CDS 100% 13.200 9.240 N Cmpk2 n/a
6 TRCN0000218965 TGGCTTCTGAAATAGCTAAAG pLKO_005 1078 CDS 100% 10.800 7.560 N Cmpk2 n/a
7 TRCN0000025133 GCTAAAGAATCAACCAACTTT pLKO.1 1092 CDS 100% 5.625 3.938 N Cmpk2 n/a
8 TRCN0000025129 GCACTTTGAATGTCTTCTGAT pLKO.1 2317 3UTR 100% 4.950 3.465 N Cmpk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020557.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.