Transcript: Mouse NM_020611.4

Mus musculus steroid 5 alpha-reductase 3 (Srd5a3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Srd5a3 (57357)
Length:
1769
CDS:
56..1048

Additional Resources:

NCBI RefSeq record:
NM_020611.4
NBCI Gene record:
Srd5a3 (57357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020611.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042269 CGAGTACGTGTCTTCAGCTAA pLKO.1 835 CDS 100% 4.950 3.960 N Srd5a3 n/a
2 TRCN0000042271 TCAGTATAAATGCCACGTCAT pLKO.1 739 CDS 100% 4.050 2.835 N Srd5a3 n/a
3 TRCN0000042268 CCCAAAGCATAGGAAAGCGTT pLKO.1 1009 CDS 100% 2.640 1.848 N Srd5a3 n/a
4 TRCN0000042272 CGTCATCTCAGTTGTGTGGAA pLKO.1 295 CDS 100% 2.640 1.848 N Srd5a3 n/a
5 TRCN0000042270 CTGGCTACTTTCTCAGTCGTT pLKO.1 328 CDS 100% 2.640 1.848 N Srd5a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020611.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.