Transcript: Mouse NM_020616.1

Mus musculus A kinase (PRKA) interacting protein 1 (Akip1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Akip1 (57373)
Length:
973
CDS:
47..685

Additional Resources:

NCBI RefSeq record:
NM_020616.1
NBCI Gene record:
Akip1 (57373)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088488 CCACCCTATAATTGCCTTAAT pLKO.1 738 3UTR 100% 13.200 18.480 N Akip1 n/a
2 TRCN0000332156 CCACCCTATAATTGCCTTAAT pLKO_005 738 3UTR 100% 13.200 18.480 N Akip1 n/a
3 TRCN0000362733 CAACCCATGTCTACCGTTATC pLKO_005 381 CDS 100% 10.800 15.120 N Akip1 n/a
4 TRCN0000362732 TCAAGTCAGTGTGGGAAATAC pLKO_005 332 CDS 100% 13.200 10.560 N Akip1 n/a
5 TRCN0000306300 AGTCTACCCAGGGACCTATTC pLKO_005 574 CDS 100% 10.800 8.640 N Akip1 n/a
6 TRCN0000306299 GACATCTGTTGGACAAGAAAG pLKO_005 478 CDS 100% 10.800 7.560 N Akip1 n/a
7 TRCN0000088490 GCAACCCATGTCTACCGTTAT pLKO.1 380 CDS 100% 10.800 7.560 N Akip1 n/a
8 TRCN0000088489 GCCTACTGAGAACATCTCTAA pLKO.1 538 CDS 100% 4.950 3.465 N Akip1 n/a
9 TRCN0000362757 GGCCTACTGAGAACATCTCTA pLKO_005 537 CDS 100% 4.950 3.465 N Akip1 n/a
10 TRCN0000088491 GTGGGAAATACTACTTGTCTA pLKO.1 342 CDS 100% 4.950 3.465 N Akip1 n/a
11 TRCN0000306301 TAGCTCTTCCTTCGGAGCAAT pLKO_005 289 CDS 100% 4.950 3.465 N Akip1 n/a
12 TRCN0000088492 TGGGAAATACTACTTGTCTAT pLKO.1 343 CDS 100% 4.950 3.465 N Akip1 n/a
13 TRCN0000306360 ATGTTGACCGTCACTACCAAC pLKO_005 685 CDS 100% 4.050 2.835 N Akip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.