Transcript: Human NM_020689.4

Homo sapiens solute carrier family 24 member 3 (SLC24A3), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
SLC24A3 (57419)
Length:
3922
CDS:
202..2136

Additional Resources:

NCBI RefSeq record:
NM_020689.4
NBCI Gene record:
SLC24A3 (57419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020689.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429775 AGCTGTTCACATCGGTCATAG pLKO_005 689 CDS 100% 10.800 8.640 N SLC24A3 n/a
2 TRCN0000043798 GCGCTCATCGTGTTTATTTAT pLKO.1 877 CDS 100% 15.000 10.500 N SLC24A3 n/a
3 TRCN0000434897 ATGAGAGACAAAGATTGATAA pLKO_005 1259 CDS 100% 13.200 9.240 N SLC24A3 n/a
4 TRCN0000043799 GCCGCTGAGTTTCGTCTTATA pLKO.1 1563 CDS 100% 13.200 9.240 N SLC24A3 n/a
5 TRCN0000043802 GCTGAGGGATTCTATTTACTA pLKO.1 840 CDS 100% 5.625 3.938 N SLC24A3 n/a
6 TRCN0000043800 GCTTGCATACATCAGTGCTTT pLKO.1 976 CDS 100% 4.950 3.465 N SLC24A3 n/a
7 TRCN0000043801 CAACGTGTTCACCTTTGTGAA pLKO.1 2091 CDS 100% 0.495 0.347 N SLC24A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020689.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.