Transcript: Human NM_020700.2

Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1H (PPM1H), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PPM1H (57460)
Length:
6454
CDS:
415..1959

Additional Resources:

NCBI RefSeq record:
NM_020700.2
NBCI Gene record:
PPM1H (57460)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336612 ACGAGAGAGGAGTTCATATAA pLKO_005 1185 CDS 100% 15.000 21.000 N PPM1H n/a
2 TRCN0000052769 GCAGGGCCATAATCATCAGAA pLKO.1 1280 CDS 100% 4.950 3.960 N PPM1H n/a
3 TRCN0000336611 CCGAGGTGGCCATTGACTATT pLKO_005 2220 3UTR 100% 13.200 9.240 N PPM1H n/a
4 TRCN0000336610 TGGGCTCAGGAGACGACATTT pLKO_005 1895 CDS 100% 13.200 9.240 N PPM1H n/a
5 TRCN0000052770 CCTAACTGTGATCCAGATGAT pLKO.1 1783 CDS 100% 4.950 3.465 N PPM1H n/a
6 TRCN0000331704 CCTAACTGTGATCCAGATGAT pLKO_005 1783 CDS 100% 4.950 3.465 N PPM1H n/a
7 TRCN0000052772 CCCTCATTGTGATTTGCCTTT pLKO.1 1226 CDS 100% 4.050 2.835 N PPM1H n/a
8 TRCN0000331708 CCCTCATTGTGATTTGCCTTT pLKO_005 1226 CDS 100% 4.050 2.835 N PPM1H n/a
9 TRCN0000052768 GCTTGGAAAGAAGATGCTCTA pLKO.1 1443 CDS 100% 4.050 2.835 N PPM1H n/a
10 TRCN0000052771 CCCAAACAGGAACTCATCCAA pLKO.1 753 CDS 100% 3.000 2.100 N PPM1H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.