Transcript: Human NM_020721.1

Homo sapiens KIAA1210 (KIAA1210), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
KIAA1210 (57481)
Length:
7838
CDS:
1..5130

Additional Resources:

NCBI RefSeq record:
NM_020721.1
NBCI Gene record:
KIAA1210 (57481)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263349 CTAGATAGATGCCGCAATTAT pLKO_005 5931 3UTR 100% 15.000 21.000 N KIAA1210 n/a
2 TRCN0000263351 TGAGACTAAGGAGCCTAAATA pLKO_005 4824 CDS 100% 15.000 10.500 N KIAA1210 n/a
3 TRCN0000263352 TGGCAGAAATCACGCAATAAA pLKO_005 5111 CDS 100% 15.000 10.500 N KIAA1210 n/a
4 TRCN0000263350 GACCTGGAAATACCTAGTTAT pLKO_005 217 CDS 100% 13.200 9.240 N KIAA1210 n/a
5 TRCN0000263348 TGGGTCTTCACCTACCAATAA pLKO_005 1710 CDS 100% 13.200 9.240 N KIAA1210 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.