Transcript: Human NM_020814.3

Homo sapiens membrane associated ring-CH-type finger 4 (MARCHF4), mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MARCHF4 (57574)
Length:
4903
CDS:
2224..3456

Additional Resources:

NCBI RefSeq record:
NM_020814.3
NBCI Gene record:
MARCHF4 (57574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020814.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130948 CGTCATCGCCATAAGCACAAA pLKO.1 2862 CDS 100% 4.950 6.930 N MARCHF4 n/a
2 TRCN0000129384 GCAGGAGCAGTTCTGCTATTT pLKO.1 3614 3UTR 100% 13.200 9.240 N MARCHF4 n/a
3 TRCN0000127530 CCAGTATTTCTTGGCTCATCT pLKO.1 2972 CDS 100% 4.950 3.465 N MARCHF4 n/a
4 TRCN0000130947 CCTCCTCAGATGACTTCTGTA pLKO.1 2624 CDS 100% 4.950 3.465 N MARCHF4 n/a
5 TRCN0000130962 CCAAGACCTTCTCTTCCAGAT pLKO.1 3027 CDS 100% 4.050 2.430 N MARCHF4 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4224 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020814.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.