Transcript: Human NM_020829.4

Homo sapiens RIC1 homolog, RAB6A GEF complex partner 1 (RIC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RIC1 (57589)
Length:
6786
CDS:
204..4475

Additional Resources:

NCBI RefSeq record:
NM_020829.4
NBCI Gene record:
RIC1 (57589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020829.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263364 TATGGTCCTTGCGTGTTATAA pLKO_005 1853 CDS 100% 15.000 21.000 N RIC1 n/a
2 TRCN0000263362 TCGGTAAGTATTAGTAGATTT pLKO_005 4584 3UTR 100% 13.200 18.480 N RIC1 n/a
3 TRCN0000263361 TGTGCCAGGAAGACCGAATAT pLKO_005 2913 CDS 100% 13.200 18.480 N RIC1 n/a
4 TRCN0000183800 CGACACATGATTCGATTTCTT pLKO.1 3129 CDS 100% 5.625 7.875 N RIC1 n/a
5 TRCN0000183186 GCCTCTTACCTTATTATCTTA pLKO.1 3021 CDS 100% 5.625 7.875 N RIC1 n/a
6 TRCN0000263363 TGTCGACACATGATTCGATTT pLKO_005 3126 CDS 100% 10.800 8.640 N RIC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020829.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.