Transcript: Human NM_020857.3

Homo sapiens VPS18 core subunit of CORVET and HOPS complexes (VPS18), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
VPS18 (57617)
Length:
3875
CDS:
320..3241

Additional Resources:

NCBI RefSeq record:
NM_020857.3
NBCI Gene record:
VPS18 (57617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381966 GAGCTGATGATCCGCTCTATC pLKO_005 3164 CDS 100% 10.800 15.120 N VPS18 n/a
2 TRCN0000380918 GTCCTCTACGTGAACCGAAAT pLKO_005 680 CDS 100% 10.800 15.120 N VPS18 n/a
3 TRCN0000155352 CGTGAACCGAAATGGACAGAA pLKO.1 688 CDS 100% 4.950 6.930 N VPS18 n/a
4 TRCN0000381871 GGCGATCTGCAGCTCACTTAA pLKO_005 2728 CDS 100% 13.200 9.240 N VPS18 n/a
5 TRCN0000381015 GGTGTCAGGTGTGAGTGTATT pLKO_005 3391 3UTR 100% 13.200 9.240 N VPS18 n/a
6 TRCN0000380291 AGAGCTACTTTGAGGAGATTG pLKO_005 1668 CDS 100% 10.800 7.560 N VPS18 n/a
7 TRCN0000379787 AGGATGTGCTGCCCTTCTTTC pLKO_005 2676 CDS 100% 10.800 7.560 N VPS18 n/a
8 TRCN0000379481 TTGACTTGGGCAAGGCAAATG pLKO_005 555 CDS 100% 10.800 7.560 N VPS18 n/a
9 TRCN0000156237 CTTCACCTGGAGAAGTCAGAA pLKO.1 3484 3UTR 100% 4.950 3.465 N VPS18 n/a
10 TRCN0000093226 GCAGTGATCATGCAGGACTAT pLKO.1 1997 CDS 100% 4.950 3.465 N Vps18 n/a
11 TRCN0000155398 CTCTACCGAGAAACCAAGGAA pLKO.1 1862 CDS 100% 3.000 2.100 N VPS18 n/a
12 TRCN0000155977 CATCTTCACAAAGCAGCGCAT pLKO.1 445 CDS 100% 2.160 1.512 N VPS18 n/a
13 TRCN0000381885 GGGATCACTTCCTGGAGAAAT pLKO_005 1386 CDS 100% 13.200 7.920 N VPS18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.