Transcript: Human NM_020859.4

Homo sapiens shroom family member 3 (SHROOM3), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SHROOM3 (57619)
Length:
10891
CDS:
825..6815

Additional Resources:

NCBI RefSeq record:
NM_020859.4
NBCI Gene record:
SHROOM3 (57619)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020859.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414634 GGCTATGATAAATGGTCTAAT pLKO_005 1851 CDS 100% 13.200 18.480 N SHROOM3 n/a
2 TRCN0000179497 GCAAACCTGAAGCACTATCAA pLKO.1 5178 CDS 100% 5.625 7.875 N SHROOM3 n/a
3 TRCN0000422422 GGAGCACGGAGAACCATTAAT pLKO_005 962 CDS 100% 15.000 10.500 N SHROOM3 n/a
4 TRCN0000417363 CACCAAGGGAAGGTACATTTA pLKO_005 884 CDS 100% 13.200 9.240 N SHROOM3 n/a
5 TRCN0000183776 CCAATGAGTTTGACAAGTATA pLKO.1 6307 CDS 100% 13.200 9.240 N SHROOM3 n/a
6 TRCN0000183305 GTTTGAACTATCTGGGTTATT pLKO.1 6897 3UTR 100% 13.200 9.240 N SHROOM3 n/a
7 TRCN0000151074 GTCTGCAACATAAAGCCTTAA pLKO.1 7226 3UTR 100% 10.800 7.560 N SHROOM3 n/a
8 TRCN0000178991 CCCACAGTAACAAACCATCTT pLKO.1 2596 CDS 100% 4.950 3.465 N SHROOM3 n/a
9 TRCN0000155434 CCTTGGTGAAGATGCCAGTAA pLKO.1 6416 CDS 100% 4.950 3.465 N SHROOM3 n/a
10 TRCN0000155171 GCAGAGAAATGGGATGCGTTT pLKO.1 3950 CDS 100% 4.050 2.835 N SHROOM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020859.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.