Transcript: Human NM_020869.3

Homo sapiens doublecortin domain containing 1 (DCDC1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-01-20
Taxon:
Homo sapiens (human)
Gene:
DCDC1 (341019)
Length:
4773
CDS:
317..2989

Additional Resources:

NCBI RefSeq record:
NM_020869.3
NBCI Gene record:
DCDC1 (341019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151323 GCTTCCAGTGAAATTCTAGAT pLKO.1 914 CDS 100% 4.950 6.930 N n/a
2 TRCN0000156402 CCGAACAGACTCAACAGGAAA pLKO.1 2478 CDS 100% 4.950 3.960 N n/a
3 TRCN0000158176 CCCAATCTTTACCTTGCGTGA pLKO.1 2017 CDS 100% 2.160 1.728 N n/a
4 TRCN0000151195 GAGATGAACTGGTGTATGTTT pLKO.1 624 CDS 100% 5.625 3.938 N n/a
5 TRCN0000151292 CAGAGCAAATTATGCCAGAAT pLKO.1 2884 CDS 100% 4.950 3.465 N n/a
6 TRCN0000155387 CCAATCTTTACCTTGCGTGAT pLKO.1 2018 CDS 100% 4.050 2.835 N n/a
7 TRCN0000157434 GCTTACCCTCATCCTCAGAAA pLKO.1 2221 CDS 100% 4.950 2.475 Y n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4475 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4475 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.