Transcript: Human NM_020877.4

Homo sapiens dynein axonemal heavy chain 2 (DNAH2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
DNAH2 (146754)
Length:
14532
CDS:
1071..14354

Additional Resources:

NCBI RefSeq record:
NM_020877.4
NBCI Gene record:
DNAH2 (146754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020877.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146535 GCCCTATTCAAAGAGCGTATT pLKO.1 3153 CDS 100% 10.800 15.120 N DNAH2 n/a
2 TRCN0000147695 GCTCTCAATGAGAGATATGAA pLKO.1 7082 CDS 100% 5.625 7.875 N DNAH2 n/a
3 TRCN0000131234 GCTTGTCTACTTCATTCGCCA pLKO.1 1481 CDS 100% 0.660 0.924 N DNAH2 n/a
4 TRCN0000131125 GCCACAGATAACACGGAACTT pLKO.1 2321 CDS 100% 4.950 3.960 N DNAH2 n/a
5 TRCN0000148727 CCAGAGATACAACACACTGAT pLKO.1 13649 CDS 100% 4.950 3.465 N DNAH2 n/a
6 TRCN0000149627 GATGCCATTCTGGAACACTTT pLKO.1 1365 CDS 100% 4.950 3.465 N DNAH2 n/a
7 TRCN0000148083 GCCACAAACTACTATTCAGTT pLKO.1 12112 CDS 100% 4.950 3.465 N DNAH2 n/a
8 TRCN0000148981 GCTAGAACTATCCAAGGCTAT pLKO.1 3602 CDS 100% 4.050 2.835 N DNAH2 n/a
9 TRCN0000146477 CTTGTCTACTTCATTCGCCAA pLKO.1 1482 CDS 100% 2.160 1.512 N DNAH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020877.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.