Transcript: Human NM_020910.3

Homo sapiens KIAA1549 (KIAA1549), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
KIAA1549 (57670)
Length:
12450
CDS:
121..5925

Additional Resources:

NCBI RefSeq record:
NM_020910.3
NBCI Gene record:
KIAA1549 (57670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020910.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417724 ACTGAAGGTTTACGAACTATT pLKO_005 3081 CDS 100% 13.200 18.480 N KIAA1549 n/a
2 TRCN0000422226 GCACAATAAAGACGACATATT pLKO_005 4206 CDS 100% 13.200 18.480 N KIAA1549 n/a
3 TRCN0000439461 ACACCACCAGGGAACGTATAA pLKO_005 3363 CDS 100% 13.200 10.560 N KIAA1549 n/a
4 TRCN0000018994 CGCACAGACAAGCTAGACTTT pLKO.1 4093 CDS 100% 4.950 3.960 N KIAA1549 n/a
5 TRCN0000018997 CCTCAAGTATTTAATACGCTT pLKO.1 1552 CDS 100% 2.640 2.112 N KIAA1549 n/a
6 TRCN0000018996 CCGTCATAAATGTGCTTATAA pLKO.1 3155 CDS 100% 15.000 10.500 N KIAA1549 n/a
7 TRCN0000422212 AGTATCCACAGCTCAACTTAT pLKO_005 3587 CDS 100% 13.200 9.240 N KIAA1549 n/a
8 TRCN0000018995 CCAGCATCTTTGTGGCAACTT pLKO.1 524 CDS 100% 4.950 3.465 N KIAA1549 n/a
9 TRCN0000018998 CCCTTCTGATTCTCTCGAGTT pLKO.1 2286 CDS 100% 0.000 0.000 N KIAA1549 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020910.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.