Transcript: Human NM_020928.2

Homo sapiens zinc finger SWIM-type containing 6 (ZSWIM6), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZSWIM6 (57688)
Length:
5518
CDS:
16..3663

Additional Resources:

NCBI RefSeq record:
NM_020928.2
NBCI Gene record:
ZSWIM6 (57688)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236692 CCAACAGCAGGTGCTAGTATA pLKO_005 1060 CDS 100% 13.200 18.480 N ZSWIM6 n/a
2 TRCN0000236691 TATTAGAAGCCGGACCATATA pLKO_005 2252 CDS 100% 13.200 18.480 N ZSWIM6 n/a
3 TRCN0000236694 TACGACTGGCATGAGCTATAC pLKO_005 3078 CDS 100% 10.800 15.120 N ZSWIM6 n/a
4 TRCN0000236690 ATTGCGTTTGCAGACTAAATT pLKO_005 3790 3UTR 100% 15.000 10.500 N ZSWIM6 n/a
5 TRCN0000252543 ATTGCGTTTGCAGACTAAATT pLKO_005 3790 3UTR 100% 15.000 10.500 N Zswim6 n/a
6 TRCN0000236693 AGGTTCAAGAACAGGTTAAAC pLKO_005 1115 CDS 100% 13.200 9.240 N ZSWIM6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.