Transcript: Human NM_020972.3

Homo sapiens zinc finger FYVE-type containing 28 (ZFYVE28), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZFYVE28 (57732)
Length:
4114
CDS:
323..2986

Additional Resources:

NCBI RefSeq record:
NM_020972.3
NBCI Gene record:
ZFYVE28 (57732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143029 CAGAGATTTCTGCGTCAAGTT pLKO.1 565 CDS 100% 4.950 6.930 N ZFYVE28 n/a
2 TRCN0000138976 CCTGAAACAGACGACAAGGAA pLKO.1 2612 CDS 100% 3.000 4.200 N ZFYVE28 n/a
3 TRCN0000244853 TGCTTGCCCGGTTCTACTATG pLKO_005 378 CDS 100% 10.800 8.640 N ZFYVE28 n/a
4 TRCN0000140449 GACGAGATGTCCTCTTTGCTT pLKO.1 1382 CDS 100% 3.000 2.400 N ZFYVE28 n/a
5 TRCN0000244854 CAATGTGTTGAACATCATTAA pLKO_005 505 CDS 100% 13.200 9.240 N ZFYVE28 n/a
6 TRCN0000244856 TGACCTGAGAAGTATTCTTAA pLKO_005 2563 CDS 100% 13.200 9.240 N ZFYVE28 n/a
7 TRCN0000257226 TGTGCCTCCCAAACGTCAAAT pLKO_005 3432 3UTR 100% 13.200 9.240 N ZFYVE28 n/a
8 TRCN0000244855 ACCAGCTGCAGACGAACTATG pLKO_005 2538 CDS 100% 10.800 7.560 N ZFYVE28 n/a
9 TRCN0000140856 CCTCAGGACTTGGCTAAACAA pLKO.1 3526 3UTR 100% 5.625 3.938 N ZFYVE28 n/a
10 TRCN0000142788 CTGAAACAGACGACAAGGAAA pLKO.1 2613 CDS 100% 4.950 3.465 N ZFYVE28 n/a
11 TRCN0000145372 GCTAAACAACATGCATCTCAT pLKO.1 3538 3UTR 100% 4.950 3.465 N ZFYVE28 n/a
12 TRCN0000139822 CAAGCCTGAAACAGACGACAA pLKO.1 2608 CDS 100% 4.050 2.835 N ZFYVE28 n/a
13 TRCN0000139579 CCACTGCTACATGTTCCATGT pLKO.1 2932 CDS 100% 4.050 2.835 N ZFYVE28 n/a
14 TRCN0000121886 GTTGAACATCATTAACCAGAT pLKO.1 511 CDS 100% 4.050 2.835 N ZFYVE28 n/a
15 TRCN0000122757 CCAAACGTCAAATGCAGGCTA pLKO.1 3440 3UTR 100% 2.640 1.848 N ZFYVE28 n/a
16 TRCN0000140327 CCAGATCATGGATGAGTGCAT pLKO.1 526 CDS 100% 2.640 1.848 N ZFYVE28 n/a
17 TRCN0000139781 CGTGTTCTTCATGGATGACGT pLKO.1 1519 CDS 100% 2.640 1.848 N ZFYVE28 n/a
18 TRCN0000122609 GCCACCAACTGCCTTCTGCAT pLKO.1 1988 CDS 100% 0.880 0.616 N ZFYVE28 n/a
19 TRCN0000140761 GTACCTGACTCAGGACATGAT pLKO.1 949 CDS 100% 0.000 0.000 N ZFYVE28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.