Transcript: Mouse NM_021053.4

Mus musculus solute carrier family 46, member 2 (Slc46a2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Slc46a2 (30936)
Length:
2060
CDS:
136..1575

Additional Resources:

NCBI RefSeq record:
NM_021053.4
NBCI Gene record:
Slc46a2 (30936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070282 CATCTCTTCAAGCAAATCGTT pLKO.1 718 CDS 100% 3.000 4.200 N Slc46a2 n/a
2 TRCN0000070279 CCAAACTCATAAAGGACTCTT pLKO.1 1325 CDS 100% 4.950 3.960 N Slc46a2 n/a
3 TRCN0000070278 CCTGCTTTGTTCTATCATCTT pLKO.1 1457 CDS 100% 4.950 3.465 N Slc46a2 n/a
4 TRCN0000070281 CGCATCGGACTCTTACTCAAA pLKO.1 499 CDS 100% 4.950 3.465 N Slc46a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.