Transcript: Human NM_021072.4

Homo sapiens hyperpolarization activated cyclic nucleotide gated potassium channel 1 (HCN1), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
HCN1 (348980)
Length:
9933
CDS:
288..2960

Additional Resources:

NCBI RefSeq record:
NM_021072.4
NBCI Gene record:
HCN1 (348980)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434460 GACTATACTCAGATCTTATTT pLKO_005 3006 3UTR 100% 15.000 21.000 N HCN1 n/a
2 TRCN0000427630 TGCTAATGCGGATCCTAATTT pLKO_005 1715 CDS 100% 15.000 21.000 N HCN1 n/a
3 TRCN0000020932 GCTCCCATCAATTATCCTCAA pLKO.1 2196 CDS 100% 4.050 5.670 N HCN1 n/a
4 TRCN0000020930 GCTGATACATATTGTCGTCTT pLKO.1 1950 CDS 100% 4.050 5.670 N HCN1 n/a
5 TRCN0000429234 ACAACAACACCATGGATTATT pLKO_005 798 CDS 100% 15.000 12.000 N HCN1 n/a
6 TRCN0000020931 CCAGTTGGAATCACATTCTTT pLKO.1 768 CDS 100% 5.625 4.500 N HCN1 n/a
7 TRCN0000020929 CGGCAGTATCAAGAGAAGTAT pLKO.1 1500 CDS 100% 5.625 3.938 N HCN1 n/a
8 TRCN0000020933 GCAGTATTCATACGCACTCTT pLKO.1 1316 CDS 100% 4.950 3.465 N HCN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.