Transcript: Human NM_021076.4

Homo sapiens neurofilament heavy (NEFH), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NEFH (4744)
Length:
3795
CDS:
46..3108

Additional Resources:

NCBI RefSeq record:
NM_021076.4
NBCI Gene record:
NEFH (4744)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021076.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434394 ACGTAAACACTTGACTATAAA pLKO_005 3377 3UTR 100% 15.000 21.000 N NEFH n/a
2 TRCN0000063755 CAAGGTGAACACAGACGCTAT pLKO.1 957 CDS 100% 4.050 3.240 N NEFH n/a
3 TRCN0000063757 GAGGTGAAGGAAGACGCTAAA pLKO.1 2788 CDS 100% 10.800 7.560 N NEFH n/a
4 TRCN0000422042 TGGACAATTATGATAGCTTAT pLKO_005 3325 3UTR 100% 10.800 7.560 N NEFH n/a
5 TRCN0000063756 GAGACCCAAGTGACTGAAGAA pLKO.1 1432 CDS 100% 4.950 3.465 N NEFH n/a
6 TRCN0000063753 GCCAAGAAGGAACCAGATGAT pLKO.1 2830 CDS 100% 4.950 3.465 N NEFH n/a
7 TRCN0000063754 CCTGCAGACAAATTCCCTGAA pLKO.1 2374 CDS 100% 4.050 2.835 N NEFH n/a
8 TRCN0000090083 CGCAATAATGAATGAGCAGTT pLKO.1 3460 3UTR 100% 4.050 2.835 N Nefh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021076.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.