Transcript: Human NM_021104.2

Homo sapiens ribosomal protein L41 (RPL41), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RPL41 (6171)
Length:
561
CDS:
41..118

Additional Resources:

NCBI RefSeq record:
NM_021104.2
NBCI Gene record:
RPL41 (6171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021104.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179654 GAGCTTGTCTCAATGGATCTA pLKO.1 220 3UTR 100% 4.950 2.970 N RPL41 n/a
2 TRCN0000180952 GCATGCTACTGTCTAGAGCTT pLKO.1 205 3UTR 100% 2.640 1.584 N RPL41 n/a
3 TRCN0000181002 GAGACCCACCTTGCTCATAAA pLKO.1 275 3UTR 100% 13.200 6.600 Y RPL41 n/a
4 TRCN0000345612 ATGAGGCAGAGGTCCAAGTAA pLKO_005 98 CDS 100% 5.625 2.813 Y Rpl41 n/a
5 TRCN0000431724 ACAGGAGCAGAAACATGGAAT pLKO_005 147 3UTR 100% 4.950 2.475 Y RPL41 n/a
6 TRCN0000442643 AGGCAGAGGTCCAAGTAAACC pLKO_005 101 CDS 100% 4.950 2.475 Y RPL41 n/a
7 TRCN0000425539 CAAGTAAACCGCTAGCTTGTT pLKO_005 112 CDS 100% 4.950 2.475 Y RPL41 n/a
8 TRCN0000182992 CTTGTCTCAATGGATCTAGAA pLKO.1 223 3UTR 100% 4.950 2.475 Y RPL41 n/a
9 TRCN0000446752 GGGATGCTGGTACAAGTTGTG pLKO_005 179 3UTR 100% 4.050 2.025 Y RPL41 n/a
10 TRCN0000439430 GTTGTGGGACTGCATGCTACT pLKO_005 194 3UTR 100% 4.050 2.025 Y RPL41 n/a
11 TRCN0000180882 GAAGAAAGATGAGGCAGAGGT pLKO.1 90 CDS 100% 2.640 1.320 Y RPL41 n/a
12 TRCN0000329146 TGAGGCAGAGGTCCAAGTAAG pLKO_005 99 CDS 100% 10.800 5.400 Y Rpl41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021104.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.