Transcript: Human NM_021116.4

Homo sapiens adenylate cyclase 1 (ADCY1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ADCY1 (107)
Length:
12657
CDS:
177..3536

Additional Resources:

NCBI RefSeq record:
NM_021116.4
NBCI Gene record:
ADCY1 (107)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021116.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294222 ACCCTCCCGCTAGCCATATTT pLKO_005 2388 CDS 100% 15.000 21.000 N ADCY1 n/a
2 TRCN0000078323 CCCGTGTTTCTCAGACTTTAA pLKO.1 7360 3UTR 100% 13.200 10.560 N ADCY1 n/a
3 TRCN0000078326 CGATGAATTAGCCACGGAGAA pLKO.1 1181 CDS 100% 4.050 3.240 N ADCY1 n/a
4 TRCN0000078325 GCTAGTATTCTGCATCTGCTT pLKO.1 2096 CDS 100% 2.640 2.112 N ADCY1 n/a
5 TRCN0000286836 GCTAGTATTCTGCATCTGCTT pLKO_005 2096 CDS 100% 2.640 2.112 N ADCY1 n/a
6 TRCN0000078324 CCTGATTCTCTCAGATATAAA pLKO.1 1637 CDS 100% 15.000 10.500 N ADCY1 n/a
7 TRCN0000286761 CCTGATTCTCTCAGATATAAA pLKO_005 1637 CDS 100% 15.000 10.500 N ADCY1 n/a
8 TRCN0000294168 CCAGCTTCAGGACGAGTATTT pLKO_005 1982 CDS 100% 13.200 9.240 N ADCY1 n/a
9 TRCN0000294221 GCGAGATGTTGACATACTTTC pLKO_005 3316 CDS 100% 10.800 7.560 N ADCY1 n/a
10 TRCN0000078327 GCATTAAGAACAGCCTCGGAA pLKO.1 1788 CDS 100% 2.640 1.848 N ADCY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021116.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.